View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17218_low_24 (Length: 282)
Name: NF17218_low_24
Description: NF17218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17218_low_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 44432534 - 44432797
Alignment:
| Q |
18 |
acctaagtcttcgttgttggatatagcggtggagagaagaagctggtcgagtttgtcaccggagtcatcgccgtttgcctgagggattttccgacgcgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44432534 |
acctaagtcttcgttgttggatatagcggtggagagaagaagctggtcgagtttgtcaccggagtcatcgccgtttgcctgagggattttccgacgcgga |
44432633 |
T |
|
| Q |
118 |
ggtttcgacgggttcatcgttggaatagccgtggcaggaggaggaaatttagggatttattatatcagaaattgaattgaattgccgtaaaagtatcttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44432634 |
ggtttcgacgggttcatcgttggaatagccgtggcaggaggaggaaatttagggatttattatatcagaaattgaattgaattgccgtaaaagtatcttt |
44432733 |
T |
|
| Q |
218 |
ccgacacatcataaaggtcgtcaaaaactcaacttgtattcttttgggtttttcaatcaaaattt |
282 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44432734 |
ccgacacatcataaa-gtcgtcaaaaactcaacttgtattcttttgggtttttcaatcaaaattt |
44432797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University