View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17219_high_13 (Length: 250)
Name: NF17219_high_13
Description: NF17219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17219_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 38484188 - 38484427
Alignment:
| Q |
1 |
ctttttgttattccggagcttattgctttggcactttttatactaccttggattagaaattttatggagaaaagaaattggaggattatttatatgttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484188 |
ctttttgttattccggagcttattgctttggcactttttatactaccttggattagaaattttatggagaaaagaaattggaggattatttatatgttca |
38484287 |
T |
|
| Q |
101 |
catggtggtttcagaggagaatttatgttggtcgtggattgagacaaggtcttgtagatagtgttaagtatactttgttttgggttgtggtgttggtttc |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38484288 |
catggtggtttcagaggagaatttacgttggtcgtggattgagacaaggtcttgtagatagtgttaaatatactttgttttgggttgtggtgttggtttc |
38484387 |
T |
|
| Q |
201 |
aaaatttagtttcagttactttttacagattaaacctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484388 |
aaaatttagtttcagttactttttacagattaaacctatg |
38484427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 149
Target Start/End: Original strand, 30118596 - 30118735
Alignment:
| Q |
10 |
attccggagcttattgctttggcactttttatactaccttggattagaaattttatggagaaaagaaattggaggattatttatatgttcacatggtggt |
109 |
Q |
| |
|
||||||||| || | ||||| || || |||||||| |||||||||||||| ||| ||||||| | ||| |||||||| |||| ||| | | ||||||| |
|
|
| T |
30118596 |
attccggaggttctggctttagccctgtttatacttccttggattagaaactttgtggagaatacaaactggaggatcttttacatgctgtcgtggtggt |
30118695 |
T |
|
| Q |
110 |
ttcagaggagaatttatgttggtcgtggattgagacaagg |
149 |
Q |
| |
|
||||||| |||| | ||||||||| || |||||| |||| |
|
|
| T |
30118696 |
ttcagagcagaagctttgttggtcggggtttgagagaagg |
30118735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University