View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17219_low_5 (Length: 366)
Name: NF17219_low_5
Description: NF17219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17219_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 3 - 93
Target Start/End: Complemental strand, 47321409 - 47321319
Alignment:
| Q |
3 |
ttttagaaatattgaagcttttcaaagctgtaagagttggaacaggtgaagctgacacagaaagatcgaagaagctggaacaattggagaa |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47321409 |
ttttagaaatattgaagcttttcaaagctgtaagagttggaacaggtgaagctgacacagaaagatcgaagaagctggaacaattggagaa |
47321319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 287 - 347
Target Start/End: Complemental strand, 47321315 - 47321255
Alignment:
| Q |
287 |
ttataataatgtgaggaatttgtttatgatttatgtgaatttgctttctatgtgtaataca |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47321315 |
ttataataatgtgaggaatttgtttatgatttatgtgaatttgctttctatgtgtaataca |
47321255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University