View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1721_high_34 (Length: 250)
Name: NF1721_high_34
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1721_high_34 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 103 - 250
Target Start/End: Complemental strand, 31026403 - 31026244
Alignment:
| Q |
103 |
ctcacatcttatattactttggcatatttaaaatatcat--gtgaggtttcagtgttaaaactaattaaaccatcatctaaattgtaagtttataattgg |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31026403 |
ctcacatcttatattactttcgcatatttaaaatatcatatgtgaggttttagtgttaaaactaattaaagcatcatctaaattgtaagtttataattgg |
31026304 |
T |
 |
| Q |
201 |
cag----------gacgaaattctaaattgtttggttcccttcactcatactagacaaat |
250 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31026303 |
cagtttaggacttgacaaaattctaaattgtttggttcccttcactcatactagacaaat |
31026244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University