View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1721_high_37 (Length: 244)
Name: NF1721_high_37
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1721_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 31796359 - 31796584
Alignment:
| Q |
1 |
ctgtaaatagcaatattatcacaagatttcagttatttgtctaaggctaccatacttctctacctaaatttgactatagtataaggggtaacatgttaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31796359 |
ctgtaaatagcaatattatcacaagatttcagttatttgtctaaggctaccatacttctctacctaaatttgactttagtataaggggtaaca---taac |
31796455 |
T |
 |
| Q |
101 |
gtgtcctataattgaaaagttaacatttatcccatcattccaaattgc--cgtttgcaaccacaattgcggccgcaatattaagatttcagagatctatg |
198 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| | ||||| |||||||| || |
|
|
| T |
31796456 |
atgtcctataataaaaaacttaacatttatcccatcattccaaattgctatatatgcaaccacaattgcggccgcaatataatgattttagagatctctg |
31796555 |
T |
 |
| Q |
199 |
caatgacaacgcaactgcaactgtgacta |
227 |
Q |
| |
|
||||| || | ||||||||| |||||||| |
|
|
| T |
31796556 |
caatggcatcacaactgcaattgtgacta |
31796584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University