View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1721_high_39 (Length: 240)
Name: NF1721_high_39
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1721_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 53 - 229
Target Start/End: Complemental strand, 48689689 - 48689513
Alignment:
| Q |
53 |
gattagaatatcaaaagatggcagataaccacaaatgaaagtgaaaattaatctgaccgcagatttagcactaaggatttcttcaaactgtctcacaagc |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48689689 |
gattagaatatcaaaagatggcagataaccacaaacgaaagtgaaaattaatctgaccgcagatttagcactaaggatttcttcaaactgtttcacaagc |
48689590 |
T |
 |
| Q |
153 |
tctggaggagaaagtctgtcaatctcagctccaagtatagaatatggaatgtcaacagctgaataagaagaataatt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48689589 |
tctggaggagaaagtctgtcaatctcagctccaagtatagaatatggaatgtcaacagctgaataagaagaataatt |
48689513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University