View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1721_low_10 (Length: 422)
Name: NF1721_low_10
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1721_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 24 - 220
Target Start/End: Complemental strand, 43285951 - 43285755
Alignment:
| Q |
24 |
agaaagatggagatgcaacagcttctgaacatgggttttcctgatgagttagctgctcaagccttagctgccactggtggtaaatccactgtcaaagcca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43285951 |
agaaagatggagatgcaacagcttctgagcatgggttttcctgatgagttagccgctcaagccttagctgccactggtggtaaatccactgtcaaagcca |
43285852 |
T |
|
| Q |
124 |
ctgaatggattcttactcataaaccccccaattccaccattcacaccccttcatcttctccttcttctgcttttcaacccaaacttgatcgtttctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43285851 |
ctgaatggattcttactcataaaccccccaattccaccattcacaccccttcctcttctccttcttctgcttttcaacccaaactcgatcgtttctt |
43285755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 362 - 406
Target Start/End: Complemental strand, 43285610 - 43285566
Alignment:
| Q |
362 |
tcatgaaccattgtacgaacgactccgacccagaacactcgacga |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43285610 |
tcatgaaccattgtacgaacgactccgacccagaacactcgacga |
43285566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 363 - 404
Target Start/End: Complemental strand, 41867550 - 41867509
Alignment:
| Q |
363 |
catgaaccattgtacgaacgactccgacccagaacactcgac |
404 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41867550 |
catgaaccattgttcgaacgactccgacccagaacactcgac |
41867509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 41867742 - 41867693
Alignment:
| Q |
171 |
ccttcatcttctccttcttctgcttttcaacccaaacttgatcgtttctt |
220 |
Q |
| |
|
|||||| |||| ||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
41867742 |
ccttcaccttcaccttcttctacttttcaacccaaactcgatcgtttctt |
41867693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 363 - 404
Target Start/End: Complemental strand, 10987303 - 10987262
Alignment:
| Q |
363 |
catgaaccattgtacgaacgactccgacccagaacactcgac |
404 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10987303 |
catgaaccattgttcgaacgactccgacccagaacactcgac |
10987262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 10987480 - 10987433
Alignment:
| Q |
173 |
ttcatcttctccttcttctgcttttcaacccaaacttgatcgtttctt |
220 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
10987480 |
ttcaccttcaccttcttctgcttttcaacccaaactcgattgtttctt |
10987433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 172 - 220
Target Start/End: Complemental strand, 1973948 - 1973900
Alignment:
| Q |
172 |
cttcatcttctccttcttctgcttttcaacccaaacttgatcgtttctt |
220 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1973948 |
cttcaccttcaccttcttctgcttttcaacccaaactcgatcgtttctt |
1973900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 404
Target Start/End: Complemental strand, 1973758 - 1973717
Alignment:
| Q |
363 |
catgaaccattgtacgaacgactccgacccagaacactcgac |
404 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1973758 |
catgaaccattgctcgaacgactccgacccagaacactcgac |
1973717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University