View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1721_low_26 (Length: 277)
Name: NF1721_low_26
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1721_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 11 - 265
Target Start/End: Complemental strand, 44858748 - 44858494
Alignment:
| Q |
11 |
ttattctccgattacataaaacaagattataaaaataaaaatataagaagaattttgcactaacattgcagttttgcaggggaaatgttgggtcttcctt |
110 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858748 |
ttattctccgattacataaaacaagataataaaaataaaaataaaagaagaattttgcactaacattgcagttttgcaggggaaatgttgggtcttcctt |
44858649 |
T |
|
| Q |
111 |
atctaccaccttttgcagataccaaagtacaaggtattgacatttccagaggagtaaactttgcttcagccggttctgggatacttgatgagacggggcg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858648 |
atctaccaccttttgcagataccaaagtacaaggtattgacatttccagaggagtaaactttgcttcagccggttctgggatacttgatgagacggggcg |
44858549 |
T |
|
| Q |
211 |
aaatctggtaatccctgtgctaattagtttgtgttaactggaactgtttttattg |
265 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44858548 |
aaatctggtaatccctgtgctaatttgtttgtgttaactggaactgtttttattg |
44858494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University