View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1721_low_33 (Length: 261)
Name: NF1721_low_33
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1721_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 260
Target Start/End: Original strand, 25966245 - 25966487
Alignment:
| Q |
18 |
ccattaacccacatgcccactgtagtgtttttatttagcaaatacaaactaaacacttttttagtacaccaattcctttggaagaatgggaatttgccac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25966245 |
ccattaacccacatgcccactgtagtgtttttatttagcaaatacaaactaaacacttttttagtacaccaattcctttggaagaatgggaatttgccac |
25966344 |
T |
 |
| Q |
118 |
ttgcatatttccacgttccattttaattcttctaatttagggtaccgtcataatttggattcactcttttcttctagttggttagggctgcgttcgaatc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25966345 |
ttgcatatttccacgttccattttaattcttctaatttagggtaccgtcataatttggattcactcttttcttctggttggttagggctgcgttcgaatc |
25966444 |
T |
 |
| Q |
218 |
ttaagttcaccatattgtaaaagtttattctcctttgctactc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
25966445 |
ttaagttcaccatattgtaaaagtttattctcttttgttactc |
25966487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University