View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1721_low_48 (Length: 236)
Name: NF1721_low_48
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1721_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 276746 - 276861
Alignment:
| Q |
104 |
aggattgcagtgtcagaaagttgattagttgaaatcttaggaaagtgagagtgcaagattaaaagtttagatgtaactaattccatttaagagaaatgaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
276746 |
aggattgcagtgtcagaaagttgattagttgaaatcttaggaaagtgtgagtgcaagattaaaagtttagatgtaattaattccatataagagaaatgaa |
276845 |
T |
|
| Q |
204 |
ttggttatagtttaac |
219 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
276846 |
ttggttatagtttaac |
276861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 276608 - 276702
Alignment:
| Q |
1 |
ttcaagatgtcgtcatatgcgaataaatatgagatgtgggaccaggccaccctttttcaagaaaagcatctaacccaattatcttattcttaatg |
95 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
276608 |
ttcaagatgtcgtcatatgtgaataaatatgagatgtgggaccaggccaccctttttcaagaaaagcatctaacccaattgtcttatttttaatg |
276702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University