View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1721_low_53 (Length: 226)
Name: NF1721_low_53
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1721_low_53 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 43141957 - 43142184
Alignment:
| Q |
1 |
ttggctacaaaatattagatttgcatgtattttcttggtttacnnnnnnnncccacattaatattgtgcatacatgatgtagtcaattacatgttcacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43141957 |
ttggctacaaaatattagatttgcatgtattttcttggtttacttttttttcccacattaatattgtgcatacatgatgtaatcaattacatgttcacat |
43142056 |
T |
|
| Q |
101 |
tgtttattatcactagtagtgtgatcataactcataagttcagttgacgtacagtt--tagctcttttatgtatgcttattcttaaaggatatacaagaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142057 |
tgtttattatcactagtagtgtgatcataactcataagttcagttgacgtacagtttatagctcttttatgtatgcttattcttaaaggatatacaagaa |
43142156 |
T |
|
| Q |
199 |
attggaattacatcttggtactatctgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43142157 |
attggaattacatcttggtactatctgt |
43142184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University