View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1721_low_57 (Length: 214)
Name: NF1721_low_57
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1721_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 33651970 - 33652168
Alignment:
| Q |
1 |
ctgatatatgtaggacatgctatagaatgaacttggttggtttcaactttttatgnnnnnnnacgacaaggacaataatcacaacatgttatgttttaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33651970 |
ctgatatatgtaggacatgctatagaatgaactttgttggtttcaactttttatgtttttttacgacaaggacaataatcacaacatgttatgttttaac |
33652069 |
T |
 |
| Q |
101 |
ttgt-aaattatattnnnnnnnntcatagtttagttttctgttaca---tagtagtacaaaatcgccaacttggttttagtttgtcttctttcatgtgtt |
196 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33652070 |
ttgtaaaattatattaaaaaaaatc--agtttagttttctgttacatagtagtagtacataatcgccaacttggttttagtttgtcttctttcatgtgtt |
33652167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University