View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1721_low_60 (Length: 209)
Name: NF1721_low_60
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1721_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 21 - 194
Target Start/End: Complemental strand, 46687791 - 46687618
Alignment:
| Q |
21 |
gaacaagttactagaacataaaaatggtgcttccaatgactatgtgtggccaagaagaacttgaattatcaagagatggtagtcactatagtctcacaac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46687791 |
gaacaagttactagaacataaaaatggtgcttccaatgactatgtgtggccaagaagaacttgaattatcaagagatggtagtcactatagtctcacaac |
46687692 |
T |
|
| Q |
121 |
cggaatattaccttctcttggtgccagaagcaaccggagagttaaactcagacccctcattatatctccctatg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46687691 |
cggaatattaccttctcttggtgccagaagcaaccggagagttaaactcagacccctcattatatctccctatg |
46687618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University