View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17220_high_12 (Length: 323)
Name: NF17220_high_12
Description: NF17220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17220_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 22 - 314
Target Start/End: Original strand, 37936762 - 37937054
Alignment:
| Q |
22 |
ttgagatcatagcaaggaataagcaaaggcttaatcgtatctttcaacgtcaaagatttaccttcgctttcttttccttgaaaaactcgcttcaacaaat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936762 |
ttgagatcatagcaaggaataagcaaaggcttaatcgtatctttcaacgtcaaagatttaccttcgctttcttttccttgaaaaactcgcttcaacaaat |
37936861 |
T |
 |
| Q |
122 |
tttcaatgctcttcgttgagaatctacggcgccggcggaaaacaccgacggatttcattttatagaattcatgattcctgtcagcaatgaaattcacagc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936862 |
tttcaatgctcttcgttgagaatctacggcgccggcggaaaacaccgacggatttcattttatagaattcatgattcctgtcagcaatgaaattcacagc |
37936961 |
T |
 |
| Q |
222 |
atctctagcagtatagagaggtctaccaaatccatcatcagctgtgatcattgcagcgagtattgcaccaatgccagtgccggtgatgatgtc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936962 |
atctctagcagtatagagaggtctaccaaatccatcatcagctgtgatcattgcagcgagtattgcaccaatgccagtgccggtgatgatgtc |
37937054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University