View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17220_low_15 (Length: 309)
Name: NF17220_low_15
Description: NF17220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17220_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 56315886 - 56316177
Alignment:
| Q |
1 |
tccctcttagctaaatggtggtggcggttagtgacgcatgttgatttccaatagaaaaaggttttggaggcttgatatagcggtggtgtaggtagaaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56315886 |
tccctcttagctaaatggtggtggtggttagtgacgcatgttgatttccaatagaaaaaggttttggaggcttgatatagcggtggtgtaggtagaaccc |
56315985 |
T |
 |
| Q |
101 |
tgcatttgtgacgccttcctctaaatcgacatgcttcagtgtagttagaacccgatatattggagagttggcatagtgacaagttttccctaggctgctt |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
56315986 |
tgcatttgtgacgccttcctctaaaacgacatgcttcagtgtagatagaacctggtatattggagagtcggcatagtgacaagatttccctaggctgctt |
56316085 |
T |
 |
| Q |
201 |
cttcnnnnnnngattttcctaggctgtaa----gcggtttcagctcaacctttagaaactgttaacggaacggggggaatggatgggtggtg |
288 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
56316086 |
cttcaaaaaaagattttcctaggctgtaagcgcgcggtttcagctcaacctttagaaactgttaacgggacggggggaatggatgggtggtg |
56316177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University