View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17220_low_21 (Length: 210)
Name: NF17220_low_21
Description: NF17220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17220_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 58 - 198
Target Start/End: Original strand, 495277 - 495417
Alignment:
| Q |
58 |
cctacattctcaatgaacggcataggaagttgtgtttccgatgtcctttttaaaccattcttggttagcacacgaaacccccatttcttcataatcaaac |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
495277 |
cctacattctcaatgaacggcataggaagttgtgtttccgatgtcctttttaaacccttcttggttagcacgcgaaacccccatttcttcataatcaaac |
495376 |
T |
 |
| Q |
158 |
catggccatcttcgccagctttaaacgtgatctgtgctcct |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
495377 |
catggccatcctcgccagctttaaacgtgatctgtgctcct |
495417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University