View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_high_12 (Length: 429)
Name: NF17222_high_12
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 20 - 303
Target Start/End: Complemental strand, 21381807 - 21381520
Alignment:
| Q |
20 |
ttcaagacgtcagaaagcaatccgaccaggtgatcgaggatagaacatatgaaggggtacatatcggcaagtatgttcg----ggctaaaacaagtttga |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
21381807 |
ttcaagatgtcagaaagcaatccgaccaggtgatcgaggatagaacatatcaacgggtacatatcggcaagtatgttcgttcgggctacaacaagtttga |
21381708 |
T |
 |
| Q |
116 |
ggttagcaagacattttttcaagataattgtgatcgcagacaatggttttcaggttttggcataatacggtctcacgcttcagattttgcaaaatatagg |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21381707 |
ggttagcaagacagggtttcaagataattgtgatcgcagacaatggttttcaggttttggcataatacggtctcacgcttcagattttggaaaatatagg |
21381608 |
T |
 |
| Q |
216 |
gtctcgcgtttcaggctttgacaacatttaccactttgatgaaaattatagggctcgagattcactttttgacaattatgaatagcaa |
303 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
21381607 |
gtctcgcgtttcaggcttggacaacatttaccactttgatgaaaattataggtctcgagattcactttttgacaattgtgaatagcaa |
21381520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University