View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_high_27 (Length: 327)
Name: NF17222_high_27
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 21 - 316
Target Start/End: Complemental strand, 33955268 - 33954973
Alignment:
| Q |
21 |
gatattgtctatctaagctagctgttattatggacataaattttaatattttgatagatgaatgtacattactattttttcactgcnnnnnnnnnnntta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33955268 |
gatattgtctatctaagctagctgttattatggacataaattttaatattttgatagatgaatgtacattactattttttcactgcaaaaaaaaaaatta |
33955169 |
T |
|
| Q |
121 |
attcgaannnnnnnnnnnnnnnnngtgaattaatagctgagaagctaggccttccatatttgaatgcataccttgatgctgttggatcaaattttagcca |
220 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33955168 |
attcgaatttttatttttcattttgtgaattaaaagctgagaagctaggccttccatatttgaatgcataccttgatgctgttggatcaaattttagcca |
33955069 |
T |
|
| Q |
221 |
tggagccaactttgcaactgctggatcaaccatcagacctcagaatacaactcttcatcaaactggtggtttcagccctttctctttggatgttca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33955068 |
tggagccaactttgcaactgctggatcaaccatcagacctcagaatacaactcttcatcaaactggtggtttcagccctttctctttggatgttca |
33954973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 231 - 271
Target Start/End: Original strand, 37441542 - 37441582
Alignment:
| Q |
231 |
tttgcaactgctggatcaaccatcagacctcagaatacaac |
271 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
37441542 |
tttgcaacagcaggatccaccatcagacctcagaatacaac |
37441582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University