View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_high_29 (Length: 307)
Name: NF17222_high_29
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 95 - 289
Target Start/End: Complemental strand, 44606244 - 44606047
Alignment:
| Q |
95 |
taattttgtaacactgtctagaactcttctaattcatccat---tttactatttagatgggagtgcagatgggagtggaagtgaatattctgatgagcaa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44606244 |
taattttgtaacactgtctagaactcttctaattcattcataattttactatttagatgggagtgcagatgggagtggaagtgaatattctgatgagcaa |
44606145 |
T |
|
| Q |
192 |
gatagaaatgatgataactctgaagatgagaatgacgcattcttcgatacatatgaaattctaacaacaagttctattagaagtaatgaatctgagga |
289 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44606144 |
gatagaaatgatgataactccgaagatgagaatgatgcattcttcgatacatatgaaattctaacaacaagttctattagaagtaatgaatctgagga |
44606047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 14 - 101
Target Start/End: Complemental strand, 44606351 - 44606264
Alignment:
| Q |
14 |
agacaattcaaggatgaaggggagtcttatctatcaacacatgaagaagatagtggtatgtttagagagatcaatattccataatttt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
44606351 |
agacaattcaaggatgaaggggagtcttatctatcaacacatgaagaagatagtggtatgtttagagagataaatattccatactttt |
44606264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University