View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_high_34 (Length: 299)
Name: NF17222_high_34
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 22 - 289
Target Start/End: Complemental strand, 11299138 - 11298877
Alignment:
| Q |
22 |
gtgggtacgtaccgccattggaccataccttgaagaattttatatcagtttatgtaattacgatgatggcttcaacctccctctcacactcctctcttgc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11299138 |
gtgggtacgtaccgccattggaccataccttgaagaattttatatcagtttatgtaattacgatgatggcttcaacctccctctcacactcctctcttgc |
11299039 |
T |
|
| Q |
122 |
tctaacctcgtctttctccggtaaagattctttcccttattgttttttagggttatgtaaaatattcttttttcgagtaatagttattttggacctcgaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11299038 |
tctaacctcgtctttctccggtaaagattctttcccttattgttttttagggttatgtaaaatattcttttttcgagtaatagttattttggacctcgaa |
11298939 |
T |
|
| Q |
222 |
tgtgtaattgaatctgtaatgagtaatcataatagtccctctatcgaaatgcaaaaatagtctctgtg |
289 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||| ||||| |
|
|
| T |
11298938 |
tgtgtaattgaatctgtaacgagtaatcgtaatagtc------tcgaaatgcaaaaatagtccctgtg |
11298877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University