View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_high_35 (Length: 284)
Name: NF17222_high_35
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 35 - 269
Target Start/End: Original strand, 7553764 - 7553999
Alignment:
| Q |
35 |
gggtttgaatccagtcatggagatgcaatagcgttaagactcttggggaggattcgccgtccatttgaatcataccaggctcgagagattagtctctgca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||| |
|
|
| T |
7553764 |
gggtttgaatccagtcatggagatgcaatagcgttaagactcttggggaggattcgccgtccatttaaatcataccaggctcgagagattagtttttgca |
7553863 |
T |
|
| Q |
135 |
gtttccacgtgaatgatatactgagtttacataaaataaaataaaagtattggatgaaactc--atgagtttcaaactttacaaatagtt-tcacgtaaa |
231 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| || |||| |||||||||||||||||||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
7553864 |
gtttccacgtgaatgatataccaagttt-catccaa-aaaaaaaaagtattggatgaaactcatattagtttcaaactttacaaatagttcccacgtaaa |
7553961 |
T |
|
| Q |
232 |
acagtgagatatatgtgagttgcactcaataacttttt |
269 |
Q |
| |
|
| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
7553962 |
atagtgagatctacatgagttgcactcaataacttttt |
7553999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 93 - 129
Target Start/End: Original strand, 41834791 - 41834827
Alignment:
| Q |
93 |
gtccatttgaatcataccaggctcgagagattagtct |
129 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
41834791 |
gtccatttgaatcctacaaggctcgagagattagtct |
41834827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University