View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_high_41 (Length: 253)
Name: NF17222_high_41
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_high_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 28020792 - 28021034
Alignment:
| Q |
1 |
ccaacatccatggttctcttaaccatgattcactttggggcactttttctttagacaacatgttcaagttgcatggtatgtcgggttccattacaagtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28020792 |
ccaacatccatggttctcttaaccatgattcactttggggcactttttctttagacaacatgttcaagttgcatggtatgtcgggttccattacaagtga |
28020891 |
T |
|
| Q |
101 |
tagataccctattattttgagccaatttcggactgaattcttcaaccttcaaggggtgcccctcatcaaaacgacaacttaccaccgtcagtccaatgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28020892 |
tagataccctattattttgagccaatttcggactgaattcttcaaccttcaaggggtgcccctcatcaaaacgacaacttaccaccgtcagtccaatgga |
28020991 |
T |
|
| Q |
201 |
caaactaagactgctaacaaaggcttgaaaacttacctctgtg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28020992 |
caaactaagactgctaacaaaggcttgaaaacttacctctgtg |
28021034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University