View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_low_16 (Length: 405)
Name: NF17222_low_16
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 3 - 386
Target Start/End: Original strand, 50014695 - 50015078
Alignment:
| Q |
3 |
aattaagacctccaaacagttgctaattttgagaaattacttcgaagatatcgactagtgcattatttgtcaagtcatccgtttcattatatcatttaga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50014695 |
aattaagacctccaaacagttgctaattttgagaaattacttcgaagatatcgactagtgcattatttgtcaagtcatccgtttcattatatcatttaga |
50014794 |
T |
 |
| Q |
103 |
accggctttgaaaacttcacttttttcttgcgttgatatcttctgcttccaggttcagcagaactgtatcaattgcggcgtgtgcatgggcaagtatttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50014795 |
accggctttgaaaacttcacttttttcttgcgttgatatcttctgcttccaggttcagcagaactgtatcaattgcggcgtgtgcatgggcaagtatttt |
50014894 |
T |
 |
| Q |
203 |
tgcgggacatgtaagctctttgatgatgatgtatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatgagccgataataagctaaccaa |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50014895 |
tgcgggacatgtaagctctttgatgatgatgtatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatgagccgataataagctaaccaa |
50014994 |
T |
 |
| Q |
303 |
tatggtcaagttatttgaaacatcaaacactataacttattgttcctatccgaaggttgatataaccttttctcttgttttgcc |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50014995 |
tatggtcaagttatttgaaacatcaaacactataacttgttgttcctatccgaaggttgatataaccttttctcttgttttgcc |
50015078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 234 - 282
Target Start/End: Complemental strand, 1780848 - 1780800
Alignment:
| Q |
234 |
tatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatga |
282 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
1780848 |
tatctaagcagcagtaccattgtaatggctgtggaatttgcaggtatga |
1780800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 282
Target Start/End: Complemental strand, 18050212 - 18050164
Alignment:
| Q |
234 |
tatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatga |
282 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||| |||||||| |
|
|
| T |
18050212 |
tatctaagcagcagtaccattgtaatggctgtggaatttgtaggtatga |
18050164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University