View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_low_37 (Length: 265)
Name: NF17222_low_37
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 48 - 244
Target Start/End: Complemental strand, 29503753 - 29503557
Alignment:
| Q |
48 |
gtatttgtaatgaaaaaacatgttttatgtacctgtgaaacatgttttttgatgttggtaccaggaagatctttaggcaaatctctgattctctgagcaa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29503753 |
gtatttgtaatgaaaaaacatgttttatgtacctgtgaaacatgttttttgatgttggtaccaggaagatctttaggcaaatctctgattctctgagcaa |
29503654 |
T |
 |
| Q |
148 |
aagatgaagaatcagcactggttgccgttgttgtcatcaatctcctcatcatcattggatgctggcatgcaactgctaatgatgatgatgaagaaga |
244 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29503653 |
aagatgaagaatcagcactggttgctgttgttgtcatcaatctcctcatcatcattggatgctggcatgcaactgctaatgatgatgatgatgaaga |
29503557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University