View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_low_41 (Length: 254)
Name: NF17222_low_41
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_low_41 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 254
Target Start/End: Complemental strand, 46861661 - 46861424
Alignment:
| Q |
16 |
aagaagtacatgtatatatacattatgcaagcagaagctatgctttcattatttactaacaatttaacttaaacttgtataagatggaaagataattaca |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46861661 |
aagaagtacatgtatatatacataatgcaagcagaagctatgctt-cattatttactaacaatttaacttaaacttgtataagatggaaagataattaca |
46861563 |
T |
|
| Q |
116 |
agtacagcaacataatttagattagataagacattcttttgtgttggtagtatattgtttcttctgattccatggtgcagaatgatttggaccattgcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46861562 |
agtacagcaacataatttagattagataagacattcttttgtgttggtagtatattgtttcttctgattccatggtgcagaatgatttggaccattgcat |
46861463 |
T |
|
| Q |
216 |
tgtgagcaaatagtgtcacatcgcaacttggcaaactcc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46861462 |
tgtgagcaaatagtgtcacatcgcaacttggcaaactcc |
46861424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University