View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_low_43 (Length: 251)
Name: NF17222_low_43
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 50119388 - 50119237
Alignment:
| Q |
18 |
aaagaagacagtaatggttggaatcaagggcttgaatattcctgtaggaaaaagatttgctcttacttggaagatgggatcataagtttagactatctca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50119388 |
aaagaagacagtaatggttggaatcaagggcttgaatatccctgtaggaaaaagatttgctcttacttggaagatgggatcataagtttagactatctca |
50119289 |
T |
 |
| Q |
118 |
tctttattatatctcaatgctagacttaaatttctatgcccctattattgtc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50119288 |
tctttattatatctcaatgctagacttaaatttctatgcccctattgttgtc |
50119237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 158 - 218
Target Start/End: Complemental strand, 50119221 - 50119161
Alignment:
| Q |
158 |
cctattattgtcctatcttcgtgtaataaagcaagaattattttgaataacattgagtttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50119221 |
cctattattgtcctatcttcgtgtaataaagcaagaattattttgaataacattgagtttt |
50119161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 50109413 - 50109331
Alignment:
| Q |
18 |
aaagaagacagtaatggttggaatcaagggcttgaatattcctgtaggaaaaagatttgctcttacttggaagatgggatcat |
100 |
Q |
| |
|
|||||| | ||| ||||||||||| |||||||| ||||| |||||||| ||||| |||||| | || |||||||||||||||| |
|
|
| T |
50109413 |
aaagaacatagtgatggttggaatgaagggcttaaatatccctgtaggtaaaagttttgctatgacctggaagatgggatcat |
50109331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University