View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_low_48 (Length: 227)
Name: NF17222_low_48
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 44454149 - 44454363
Alignment:
| Q |
1 |
tttatgtaacatttttcaattaagaaacataatcaccgtgcaaaaatttaacatgaaaaacacaaaaaccacagggagaaaatcatggttgttgtctaat |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || ||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44454149 |
tttatgtaacattttccaattaagaaacataatcactgtacaagaatttaacatgaaaaacataaaaaccacaggaagaaaatcatggttgttgtctaat |
44454248 |
T |
|
| Q |
101 |
aacatctaaagaagtgaannnnnnnactaacacatagagttctcttaaacaccaaatactcgatagtacacttgcatgttacacccttcaaaccaaataa |
200 |
Q |
| |
|
| |||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44454249 |
agcatctaaagaagtgaatttttttac-aacacatagagttctcttaaacaccaaatatccgatagtacacttgcatgttacacccttcaaaccaaataa |
44454347 |
T |
|
| Q |
201 |
ttaaacgacatttcat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44454348 |
ttaaacgacatttcat |
44454363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University