View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_low_49 (Length: 225)
Name: NF17222_low_49
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_low_49 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 225
Target Start/End: Complemental strand, 46861296 - 46861081
Alignment:
| Q |
10 |
ggatgggattaaaaggaacatatttcaattaaggtcgatctaagtagtaagagagtcggacactttaaacaagtgattagaagtttaaattgtcttttgt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46861296 |
ggatgggattaaaaggaacatatttcaattaaggtcgatctaagtagtaagagagtcggacactttaaacaagtgatcagaagtttaaattgtcttttgt |
46861197 |
T |
 |
| Q |
110 |
gtatggaaaaaacatgattgggtagagagaactcatccaaacaagttctctaatgaagattaataatttaatacaatgttagatactttctaccaataat |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
46861196 |
gtatggaaaaaacatgatcgggtagagagaactcatccaaacaagttctctaatgaagattaataatttaatacaatgttagatagtttctaccgataat |
46861097 |
T |
 |
| Q |
210 |
atgatttcaaaaacaa |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46861096 |
atgatttcaaaaacaa |
46861081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University