View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_low_50 (Length: 221)
Name: NF17222_low_50
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 4 - 143
Target Start/End: Complemental strand, 7116940 - 7116801
Alignment:
| Q |
4 |
gtcccttatgttggccacgggcatggtcattgacttctgaagcttcttttcaggatcaggctgcatcatcatcataaacattaatttcaaatttggaatt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
7116940 |
gtcccttatgttggccacgggcatggtcattgacttctgaagcttcttttcaggatcaggctgcatcatcatcataaacattaatttcatacttggaatt |
7116841 |
T |
 |
| Q |
104 |
gtctgttactccatcatgaaataaaaacattaaaattgga |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7116840 |
gtctgttactccatcatgaaataaaaacattaaaattgga |
7116801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 209
Target Start/End: Complemental strand, 7116774 - 7116743
Alignment:
| Q |
178 |
gaaattaatgagttaaatatatttttcatctc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7116774 |
gaaattaatgagttaaatatatttttcatctc |
7116743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University