View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17222_low_53 (Length: 203)
Name: NF17222_low_53
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17222_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 60 - 185
Target Start/End: Original strand, 25656375 - 25656500
Alignment:
| Q |
60 |
tgattgtaatcgaatgattatagtgaattaagtcttcaactatagagagacaaattatgtccgcagacgagactaaaggcagctgtcggttagattgcga |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
25656375 |
tgattgtaatcgaatgattatagtgaattaagtcttcgactgtagagagacaaattctgtccgcagacgagactaaaggcagctgtcggtcagattgtga |
25656474 |
T |
 |
| Q |
160 |
accaatataaaacataatgcgtcttt |
185 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
25656475 |
accaatataaaacataatgtgtcttt |
25656500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 42
Target Start/End: Original strand, 25656343 - 25656373
Alignment:
| Q |
12 |
gaagaaaatctgatgtacgaccagtttgcaa |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25656343 |
gaagaaaatctgatgtacgaccagtttgcaa |
25656373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University