View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17223_low_7 (Length: 249)
Name: NF17223_low_7
Description: NF17223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17223_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 51474120 - 51474367
Alignment:
| Q |
1 |
ttccctggatctggaacctctcattctttattgtctcgtgccatctctccagcgttgtttcccctctgttcaattgaaatacaaatttctcaaatttcaa |
100 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51474120 |
ttccctggatctagatcctctccttctttattgtctcgtgccatctctccagcgttgtttcccctttgttcaattgaaatacaaatttctcaaatttcaa |
51474219 |
T |
 |
| Q |
101 |
gttttggatggggttgtagatttggcttctgagcaatctccggtgccgacaaagacattttttatgcacttgagaaacgacagattcgctacagttgaat |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51474220 |
gttttggatggggttgtagattcggcttctgagcaatctccggtgccgacaaagacattttttctgcacttgagaaacgacagattcgctagagttgaat |
51474319 |
T |
 |
| Q |
201 |
tgattttgtgtgtttttaaaagttggggttttgatctgtgatgctgct |
248 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||| || | ||||||| |
|
|
| T |
51474320 |
tgattctgtgtgtttctgaaagttggggttttgatttgagttgctgct |
51474367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 159
Target Start/End: Complemental strand, 51854056 - 51854002
Alignment:
| Q |
105 |
tggatggggttgtagatttggcttctgagcaatctccggtgccgacaaagacatt |
159 |
Q |
| |
|
|||||| ||||||||||| |||| ||||| ||||||| |||||||||||||||| |
|
|
| T |
51854056 |
tggatgaggttgtagattcagcttttgagcgatctccgatgccgacaaagacatt |
51854002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University