View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17224_low_3 (Length: 315)
Name: NF17224_low_3
Description: NF17224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17224_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 41009507 - 41009210
Alignment:
| Q |
1 |
tgaaacgtaatggagtccagggcctaacaaacagtgattatttgagttcctttgaatcattggctttggtctttgcaccttcttataaaagagcatttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41009507 |
tgaaacgtaatggagtccagggcctaacaaacagtgattatttgagttcctttgaatcattggctttggtctttgcaccttcttataaaagagcatttac |
41009408 |
T |
 |
| Q |
101 |
tcttgtgaagaacagaagacaaatgcatcaaacatgtctccagcagcagaagatgttggtacaatgataacatttaccaagtgcaaaactcagataccaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41009407 |
tcttgtgaagaacagaagacaaatgcatcaaacatgtttccagcagcagaagatgttgttacaatgataacatttaccaagtgcaaaactcagataccaa |
41009308 |
T |
 |
| Q |
201 |
tataggttgattttattgacatataccaaattaatgtatctctctctttctaacacaagtagaacataacaaaataaaaaactcattcagcaattatt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41009307 |
cataggttgattttattgacatataccaaattaatttatctctctctttctaacacaagtagaacataacaaaattaaaaactcattcagcaattatt |
41009210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University