View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17224_low_5 (Length: 263)
Name: NF17224_low_5
Description: NF17224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17224_low_5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 20 - 263
Target Start/End: Complemental strand, 39591874 - 39591631
Alignment:
| Q |
20 |
cttaccttactgcttgcatttatttttattccataccttgcaagccagttggtatttgcaaaagggagaaacaatgttagagaagcttgcaaagtaacta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591874 |
cttaccttactgcttgcatttatttttattccataccttgcaagccagttggtatttgcaaaagggagaaacaatgttagagaagcttgcaaagtaacta |
39591775 |
T |
|
| Q |
120 |
ggtatcaaaacctttgtatgcgctcgctagcaccgttctctaacagtgctggaagaggccctagcaagtgggcaagggctggagtgtcggtgacaatcgg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591774 |
ggtatcaaaacctttgtatgcgctcgctagcaccgttctcttacagtgctggaagaggccctagcaagtgggcaagggctggagtgtcggtgacaatcgg |
39591675 |
T |
|
| Q |
220 |
tgaagttaagaatgtccaagcatatctcgcaaacttaactagac |
263 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39591674 |
tgaagttaagaatgtccaagcatatctcacaaacttaactagac |
39591631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University