View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17225_high_3 (Length: 522)
Name: NF17225_high_3
Description: NF17225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17225_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 6e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 16142190 - 16142259
Alignment:
| Q |
19 |
tattttacctgaaatataatcttcttaatctattttgaaatttgggttgttgatccaacagtttcatgat |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16142190 |
tattttacctgaaatataatcttcttaatctattttgaaatttgggttgttgatcaaacagtttcatgat |
16142259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University