View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17226_low_10 (Length: 250)
Name: NF17226_low_10
Description: NF17226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17226_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 49292667 - 49292429
Alignment:
| Q |
1 |
cacataatgcagatttcagttggctagttataatataatgtcaatgagaatgtgttaaaaaacttgcatagttnnnnnnnnttaactacttcgannnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49292667 |
cacataatgcagatttcagttggctagttataatataatgtcaatgagaatgtgttaaaaaacttgcatagttaaaaaat-ttaactacttcgatttttg |
49292569 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnacgaacagaaagctttggattttactcttaaggttgttggtggtgatatttcaaccttaccaggggtatctgaagctattgaggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49292568 |
tttttgtttgttttacgaacagaaagctttggattttactcttaaggttgttggtggtgatatttcaaccttaccaggggtatctgaagctattgaggta |
49292469 |
T |
 |
| Q |
201 |
caagaaaattattttgaaagacaattttgttactcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49292468 |
caagaaaattattttgaaagacaattttgttactcctttg |
49292429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University