View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17226_low_11 (Length: 249)
Name: NF17226_low_11
Description: NF17226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17226_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 22 - 233
Target Start/End: Original strand, 39232866 - 39233080
Alignment:
| Q |
22 |
gcatcaagtccaccaccacaactaa-tgcaacaactacacttgagtttaaggttgcttggttgtccctgnnnnnnnnnnnnnnn--gaattaaggtgact |
118 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39232866 |
gcatcaaatccaccaccacaactaaatgcaacaactacacttgagtttaaggttgcttggttgtccctgaaaaaaaaaacaaaaaagaattaaggtgact |
39232965 |
T |
 |
| Q |
119 |
tggagttggatggacgttgcttaaagttcaactgctacggctttgttaagtaaacttgccctatagataaaagaaattcaaccaatccaatttctttggt |
218 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39232966 |
tggagttggaaggacgttgcttaaagttcaactgctacggctttgttaagtaaacttgccccatagataaaagaaattcaaccaatccaatttctttggt |
39233065 |
T |
 |
| Q |
219 |
tgcttaaaaatcaac |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39233066 |
tgcttaaaaatcaac |
39233080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University