View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17227_high_8 (Length: 279)
Name: NF17227_high_8
Description: NF17227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17227_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 11802347 - 11802102
Alignment:
| Q |
19 |
tttgttcccttcttttatttcttttaggatatttttccatggctttatatttgtctctgccctgttttatgtaaaaaatatcaatagttgaaatgttgtc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11802347 |
tttgttcccttcttttatttcttttaggatatttttccatggctttatatttgtctctgccctgttttatgtaaaaattatcaatagttgaaatgttgtc |
11802248 |
T |
|
| Q |
119 |
taactagatggaaaaatataatgtgcaannnnnnngtgctttgtgtacaatttaaatatgcataatataagtttgttgaaataccaccatcacttgcaca |
218 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11802247 |
tagctagatggaaaaatataatgtgcaatttttttgtgctttgtgtacaatttaaacatgcataatataagtttgttgaaacaccaccatcacttgcaca |
11802148 |
T |
|
| Q |
219 |
ctattttataaaggttaaatttgtatgatataaatatttgtacgat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11802147 |
ctattttataaaggttaaatttgtatgatataaatatttgtacgat |
11802102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 18 - 116
Target Start/End: Complemental strand, 11810206 - 11810108
Alignment:
| Q |
18 |
ttttgttcccttcttttatttcttttaggatatttttccatggctttatatttgtctctgccctgttttatgtaaaaaatatcaatagttgaaatgttg |
116 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| || ||| ||| ||||| |
|
|
| T |
11810206 |
ttttgttcccttcttttatgtctttaaggatattgttccatggctttatatttgtctctgccctgttttaagtaaaaaatattaaaagtagaagtgttg |
11810108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University