View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17227_low_13 (Length: 242)
Name: NF17227_low_13
Description: NF17227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17227_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 8122853 - 8123070
Alignment:
| Q |
1 |
tagtatttacttaattatttaaaatgtttttattagttaatgaaatgaattgagtttgctttcatgaacaaaaaagaccattgcttatgcaacagcattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
8122853 |
tagtatttacttaattatttaaaatgtttttattaattaatgaaatgaattgagtttgctttcatgaacaaaaaacaccattgcttatgcaatagcattg |
8122952 |
T |
 |
| Q |
101 |
caaagtctaactaatgattgagagctccaaatgcatgcccaattgagcttccaatgaagatttgtaggatagtatttgactttgaaaaactgtgaaatca |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8122953 |
ccaagtctaactaatgattgagagctccaaatgcatgcccaattgagcttccaatgaagatttgtaggatagtatttgactttgaaaaactgtgaaatca |
8123052 |
T |
 |
| Q |
201 |
aagcatttgtgttggtta |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8123053 |
aagcatttgtgttggtta |
8123070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University