View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723-Insertion-2 (Length: 149)
Name: NF1723-Insertion-2
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1723-Insertion-2 |
![](./plan/images/spacer.gif) | ![NF1723-Insertion-2](./plan/images/spacer.gif) |
|
[»] chr2 (1 HSPs) |
![](./plan/images/spacer.gif) | ![chr2 (8-149)||(36921560-36921701)](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 8 - 149
Target Start/End: Complemental strand, 36921701 - 36921560
Alignment:
Q |
8 |
ctaatcaatcttttcttcataatcttgtcaaaaatatattttcttcataattcataacccacttttaattaattttattttaccctacttattaatatct |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36921701 |
ctaatcaatcttttcttcataatcttgtcaaaaatatattttcttcataattcataacccacttttaattaattttattttaccctacttattaatatct |
36921602 |
T |
![](./plan/images/spacer.gif) |
Q |
108 |
tgttttccccgaccagtctagtcccatcctaaccattcacaa |
149 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36921601 |
tgttttccccgaccagtctagtcccatcctaaccattcacaa |
36921560 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 20459 times since January 2019
Visitors: 1285