View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17230_high_4 (Length: 339)
Name: NF17230_high_4
Description: NF17230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17230_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 9e-61; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 23540605 - 23540475
Alignment:
| Q |
1 |
ctactgtaaacatacaggttgtcttcatcttcatcactagacccattgatatcaacacaacaaggctccaatactttcacataactgtccctggtattat |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23540605 |
ctactataaacatacaggttgtcttcatcttcatcactagacccattgatatcaacacaacaaggctccaatactttcacataactgtccctgatattat |
23540506 |
T |
|
| Q |
101 |
gctccacatatacatgaccatctacttcttc |
131 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
23540505 |
gctccacatatacatgagcatctacttcttc |
23540475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 262 - 326
Target Start/End: Complemental strand, 23540072 - 23540008
Alignment:
| Q |
262 |
attctaaaattgattctttttcagcaactttttgatcaattggagcattgactgggaccgcaaca |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
23540072 |
attctaaaattgattctttttcagcaactttttgttcaattagagcattgactgggaccacaaca |
23540008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 23540193 - 23540148
Alignment:
| Q |
140 |
aaacaaaataaaccaataatgttaggacacgtgtcactcacgaccc |
185 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23540193 |
aaacaaaataaaccaataatgttaagacacgtgtcactcacgaccc |
23540148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University