View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17231_low_10 (Length: 258)
Name: NF17231_low_10
Description: NF17231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17231_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 33479042 - 33479223
Alignment:
| Q |
13 |
agaacctgtgcttgaactcgagcattagtaaaaatgtaagttggggttgatagctttagaaaaggtgagttttcatgtccacacgacaaaaataaggagg |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33479042 |
agaacttgtgcttgaactcgagcattagtaaaaatgtaagttggggttgatagctttagaaaaggtgagttttcatgtccacataacaaaaataaggagg |
33479141 |
T |
|
| Q |
113 |
ggaattgaatttgaacctgatgtcttatatctcttaacccgtaatctgcttcaacaatatcatcaagcgaccttatttataa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33479142 |
ggaattgaatttgaacctgatgtcttatatctcttaacccgtaatctgcttcaacaatatcatcaaacgaccttatttataa |
33479223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 190 - 227
Target Start/End: Complemental strand, 33479234 - 33479197
Alignment:
| Q |
190 |
tataacttcaattataaataaggacgcttgatgatatt |
227 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
33479234 |
tataacttcaattataaataaggtcgtttgatgatatt |
33479197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University