View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17231_low_12 (Length: 252)
Name: NF17231_low_12
Description: NF17231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17231_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 2 - 222
Target Start/End: Complemental strand, 42352819 - 42352597
Alignment:
| Q |
2 |
ccacctcttaattccttcacagggactgatgtgagaacttcatattctcttgattcagacatgatttgaaatgaaaagatgcattctttggaa------t |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| | |
|
|
| T |
42352819 |
ccacctcttaattccttcacagggactgatgtgagaacttcatattctcttgatttagacatgattt-----gaaaagatgcattctttggaatgtaatt |
42352725 |
T |
 |
| Q |
96 |
atgtaacaaacttctcctgcaaattgacacattataaagaaaatnnnnnnntcattattatatc-aaaaaagtagaatttagttatgtgatcttaaaaca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42352724 |
atgtaacaaacttctcctgcaaattgacacattataaagaaaataaaaaaaccattattatatcaaaaaaagtagaatttagttatgtgatcttaaaaca |
42352625 |
T |
 |
| Q |
195 |
taccactatgatagcaaaatacaatgac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42352624 |
taccactatgatagcaaaatacaatgac |
42352597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University