View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17231_low_7 (Length: 335)
Name: NF17231_low_7
Description: NF17231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17231_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 2 - 319
Target Start/End: Original strand, 48059453 - 48059774
Alignment:
| Q |
2 |
ttattcttataaatttacgggttaatattaataataaaaagggataaaatccaccaaaagaattgcagggaaccctgggggacgggacaaataagacggg |
101 |
Q |
| |
|
||||| ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48059453 |
ttatttttataaatttaagggttaatactaataataaaaagggataaaatccaccaaaagaattgcagggaaccctgggggacgggacaaataagacggg |
48059552 |
T |
 |
| Q |
102 |
gatcttgaaaataactc-------aatcttgaatgcataaaatcactaattatcaatttattattattaacaaccaatcaagcaacataatttattacct |
194 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48059553 |
gatcttgaaaataactcaatcttgaatcttgaatgcataaaatcactaattatcaatttattattattaacaaccaatcaagcaacataatctattacct |
48059652 |
T |
 |
| Q |
195 |
t-nnnnnnnnnnntattagtacgtagctctaaatatagtgtggtaacttacagatatgtcgttttccgcatgtccgggaacaaccgcctttccttgccca |
293 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48059653 |
taaaaaaaatatatatta----gtagctctaaatatagtgtggtaacttacagatatgtcgttttccgcatgtccgggaacaaccgtctttccttgccca |
48059748 |
T |
 |
| Q |
294 |
tctagttcaacattaattcttggtat |
319 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48059749 |
tctagttcaacattaattcttggtat |
48059774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University