View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17232_high_3 (Length: 510)
Name: NF17232_high_3
Description: NF17232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17232_high_3 |
 |  |
|
| [»] scaffold0933 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 13 - 57
Target Start/End: Complemental strand, 31209990 - 31209946
Alignment:
| Q |
13 |
cacagataagtttactgttctctcttttaactatattttattgat |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31209990 |
cacagataagtttattgttctctcttttatctatattttattgat |
31209946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 56
Target Start/End: Complemental strand, 2609557 - 2609517
Alignment:
| Q |
16 |
agataagtttactgttctctcttttaactatattttattga |
56 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
2609557 |
agataagtttattgttctctcttttacctatattttattga |
2609517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 149
Target Start/End: Complemental strand, 31206477 - 31206448
Alignment:
| Q |
120 |
gtagataattcttatgactaattctacaac |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31206477 |
gtagataattcttatgactaattctacaac |
31206448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 13 - 57
Target Start/End: Complemental strand, 6671306 - 6671262
Alignment:
| Q |
13 |
cacagataagtttactgttctctcttttaactatattttattgat |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6671306 |
cacagataagtttattgttctctcttttagctatattttattgat |
6671262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 13 - 57
Target Start/End: Complemental strand, 6667634 - 6667590
Alignment:
| Q |
13 |
cacagataagtttactgttctctcttttaactatattttattgat |
57 |
Q |
| |
|
|||| ||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6667634 |
cacatataagtttattgttctctcttttagctatattttattgat |
6667590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0933 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0933
Description:
Target: scaffold0933; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 965 - 1006
Alignment:
| Q |
16 |
agataagtttactgttctctcttttaactatattttattgat |
57 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
965 |
agataagtttattgttctctcttttacctatattttattgat |
1006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 253 - 294
Target Start/End: Original strand, 17884634 - 17884675
Alignment:
| Q |
253 |
atccaagagttggaatgcttaccaaaatcagaagtagaattg |
294 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||| |
|
|
| T |
17884634 |
atccaaaagttggaatgcttaccaaaatcagaattggaattg |
17884675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 13 - 57
Target Start/End: Complemental strand, 1788814 - 1788770
Alignment:
| Q |
13 |
cacagataagtttactgttctctcttttaactatattttattgat |
57 |
Q |
| |
|
|||||||||||||| ||||||| |||||| |||||||||||||| |
|
|
| T |
1788814 |
cacagataagtttattgttctcccttttagatatattttattgat |
1788770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 13 - 57
Target Start/End: Original strand, 1043561 - 1043605
Alignment:
| Q |
13 |
cacagataagtttactgttctctcttttaactatattttattgat |
57 |
Q |
| |
|
|||||||||||||| |||| |||||| || ||||||||||||||| |
|
|
| T |
1043561 |
cacagataagtttattgttttctcttatagctatattttattgat |
1043605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University