View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17232_high_6 (Length: 445)
Name: NF17232_high_6
Description: NF17232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17232_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 50245241 - 50245039
Alignment:
| Q |
18 |
aagaataatcatgtc--acttgatcttttaatatgactgattgatataatggtagaaacaaattcatatatggtacagcttaactcatttatgtaagata |
115 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50245241 |
aagaataatcatgtctcacttgatcttttaatatgactgattgatataatggtagaaacaaattcatatatggtacagcttaactcatttatgtaagata |
50245142 |
T |
 |
| Q |
116 |
gaactagcctaaattttatcattttgtgtctgtctatcagaaattacatcccaaaacagtgctacaccttgaccaagaggacgaagagggaaatatagaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50245141 |
gaactagcctaaattttatcattttgtgtctgtctatcagaaatttcatcccaaaacagtgctacaccttgaccaagaggacgaagagggaaatatagaa |
50245042 |
T |
 |
| Q |
216 |
aag |
218 |
Q |
| |
|
||| |
|
|
| T |
50245041 |
aag |
50245039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 297 - 440
Target Start/End: Complemental strand, 50244959 - 50244816
Alignment:
| Q |
297 |
ccttctttgaaaattatcatggcctgcctcaaaaaaccattgctgaattcacctgaacttcaaagaactcttcaacaccctctcttacgtccaagaactc |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50244959 |
ccttctttgaaaattatcatggcctgcctcaaaaaaccattgctgaattcacctgaacttcaaagaactcttcaacaccctctcttacgtccaagaactc |
50244860 |
T |
 |
| Q |
397 |
acattttaacagtcccttttttacttctctctctgctcctcctc |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
50244859 |
acattttaacagtcccttttttacttctctctctgtttctcctc |
50244816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University