View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17232_low_15 (Length: 235)
Name: NF17232_low_15
Description: NF17232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17232_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 28478671 - 28478890
Alignment:
| Q |
1 |
atatatcctagaagtatatctgattgnnnnnnnnncttgtttttaaaaaatatattgtcggatacatttgggattctttgtaaaatacatcttcgttgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28478671 |
atatatcctagaagtatatctgattgttttttt--cttgtttttaaaaaatatattgtcggatacatttgggattctttgtaaaatacatcttcgttgag |
28478768 |
T |
|
| Q |
101 |
ggtgtgatgcatataagtttattaacgtttataagtcatgtcatgtcatgagtttaaataatttatgtatttgtgtcgtatcacacttgtatatgcagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28478769 |
ggtgtgatgcatataagtttattaacgtatataagtcgtgtcatgtcatgagtttaaataatttatgtatttgtgtcgtatcacacttgtatatgcagta |
28478868 |
T |
|
| Q |
201 |
tgtatcaagctacatagttatt |
222 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
28478869 |
tgtatcaagatacatagttatt |
28478890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 118 - 222
Target Start/End: Original strand, 28470282 - 28470387
Alignment:
| Q |
118 |
tttattaacgtttataagtcatgtcatgtcatgagtttaaataatttatgtatttgtgtcgtatcacacttgtatatgcagtatgtatc-aagctacata |
216 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| | |||||||| |
|
|
| T |
28470282 |
tttattaacgtatataagtcgtgtcatgtcatgagtttaaataatttatgtatttgtttcgtatcacacttgtatatgtagtatgtatcgaggctacata |
28470381 |
T |
|
| Q |
217 |
gttatt |
222 |
Q |
| |
|
|||||| |
|
|
| T |
28470382 |
gttatt |
28470387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University