View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17233_high_8 (Length: 221)
Name: NF17233_high_8
Description: NF17233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17233_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 30748838 - 30748633
Alignment:
| Q |
1 |
tacctgaacttagtccatccccgtgagattttatatggaattagcttatcgtccggcttcaaattctttggtttcttgtcgaaccagacaaaacctctgc |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30748838 |
tacctgaacttagtccatccctgtgagattttatatggaattagcatattgtccggcttcaaattctttggtttcttgtcgaaccagacaaaacctctgc |
30748739 |
T |
|
| Q |
101 |
aatcagttggattccaccaaagcttgctgtagttgctacggctatgccacattttcgatgaaccagcaatgccgaatacaatatgtgagatgtttgttgg |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30748738 |
aagcagttggattccaccaaagcttgctgtagttgctacggctatgccacattttcgatgaaccagcaatgccgaatacaatatgtgagatgtttgttgg |
30748639 |
T |
|
| Q |
201 |
tattgt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
30748638 |
tattgt |
30748633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University