View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17233_high_9 (Length: 214)

Name: NF17233_high_9
Description: NF17233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17233_high_9
NF17233_high_9
[»] chr4 (1 HSPs)
chr4 (1-198)||(39327050-39327248)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 39327050 - 39327248
Alignment:
1 aagattagttgacttctaactataggttaatgcaaacacaacatgctatttttgtgtttagtgtttgtctttagcaaatacggtcattgccttttaacat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
39327050 aagattagttgacttctaactataggttaatgcaaacacaacatgctatttttgtatttagtgtttgtctttagcaaatacggtcattgccttttaacat 39327149  T
101 tgatttaataattgcttaatttatgaaagtatagag-ttttttaaccacaagttaaaaagtaataaattcagaaatgtaactatgttcacaatggaaag 198  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
39327150 tgatttaataattgcttaatttatgaaagtatagagtttttttaaccacaagttaaaaagtaataaattcagaaatttaactatgttcacaatggaaag 39327248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University