View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17233_low_3 (Length: 542)
Name: NF17233_low_3
Description: NF17233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17233_low_3 |
 | |
|
| [»] scaffold0002 (2 HSPs) |
| | |
|
| [»] scaffold0902 (3 HSPs) |
| | |
|
| [»] scaffold1176 (2 HSPs) |
| | |
|
| [»] scaffold1777 (1 HSPs) |
| | |
|
| [»] scaffold1118 (1 HSPs) |
| | |
|
| [»] scaffold1652 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 285; Significance: 1e-159; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 165 - 523
Target Start/End: Original strand, 164702 - 165070
Alignment:
| Q |
165 |
gtttccatataatagtggttatatgataagatcagttgaagaattgaaatactataaattggcaattgttt----------gttacgggagagggatatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
164702 |
gtttccatataatagtggttatatgataagatcagttgaagaattgaaatactataaattggcaattgtttattattgtttgttacgggagagagatatt |
164801 |
T |
|
| Q |
255 |
ttcttatgtaaagcttgtatctattaatctaaaataaatcctcacaaaacaaatatctnnnnnnnccaataacacagtaatcttccaacaaataaatacg |
354 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
164802 |
ttcttatgtaaagcttctatctattaatctaaaataaatcctcacaaaacaaatatctaaaaaaaccaataacacaataatcttccaacaaataaatacg |
164901 |
T |
|
| Q |
355 |
cgtttaagcatatatataaataaccttccaaccctaatattttcttcactcaaaactttctagttaaccctaatattcccattctcgttcatctttctac |
454 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
164902 |
cgtttaagcttatatataaataaccttccaaccctaatattttcttcactcaaaactttctagttaaccctaatattcccattctcgttcatctttctac |
165001 |
T |
|
| Q |
455 |
tatggcttcttctcacaccgctgtgttgatgcttttggttgcactgtttctgagttccgctgttgctcg |
523 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
165002 |
tatggcttcttctcactcggctgtgttgatgcttttcgttgcactgtttctgagttccgctgttgctcg |
165070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 8 - 97
Target Start/End: Original strand, 164545 - 164634
Alignment:
| Q |
8 |
tgatgataatgcggcggttctcattgataatgaaggaaatccaaaaggaactagaactgtttccgcaatagcccgagaattgagacttga |
97 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
164545 |
tgatgataatgcggtggttctcattgataatgaaggaaatccaaaaggaactagaattttttccgcaatagcccgagaattgagacttga |
164634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 285; Significance: 1e-159; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 165 - 523
Target Start/End: Complemental strand, 14249024 - 14248656
Alignment:
| Q |
165 |
gtttccatataatagtggttatatgataagatcagttgaagaattgaaatactataaattggcaattgttt----------gttacgggagagggatatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
14249024 |
gtttccatataatagtggttatatgataagatcagttgaagaattgaaatactataaattggcaattgtttattattgtttgttacgggagagagatatt |
14248925 |
T |
|
| Q |
255 |
ttcttatgtaaagcttgtatctattaatctaaaataaatcctcacaaaacaaatatctnnnnnnnccaataacacagtaatcttccaacaaataaatacg |
354 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14248924 |
ttcttatgtaaagcttctatctattaatctaaaataaatcctcacaaaacaaatatctaaaaaaaccaataacacaataatcttccaacaaataaatacg |
14248825 |
T |
|
| Q |
355 |
cgtttaagcatatatataaataaccttccaaccctaatattttcttcactcaaaactttctagttaaccctaatattcccattctcgttcatctttctac |
454 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14248824 |
cgtttaagcttatatataaataaccttccaaccctaatattttcttcactcaaaactttctagttaaccctaatattcccattctcgttcatctttctac |
14248725 |
T |
|
| Q |
455 |
tatggcttcttctcacaccgctgtgttgatgcttttggttgcactgtttctgagttccgctgttgctcg |
523 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14248724 |
tatggcttcttctcactcggctgtgttgatgcttttcgttgcactgtttctgagttccgctgttgctcg |
14248656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 8 - 97
Target Start/End: Complemental strand, 14249181 - 14249092
Alignment:
| Q |
8 |
tgatgataatgcggcggttctcattgataatgaaggaaatccaaaaggaactagaactgtttccgcaatagcccgagaattgagacttga |
97 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
14249181 |
tgatgataatgcggtggttctcattgataatgaaggaaatccaaaaggaactagaattttttccgcaatagcccgagaattgagacttga |
14249092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 418 - 523
Target Start/End: Complemental strand, 14317313 - 14317203
Alignment:
| Q |
418 |
ttaaccctaatattcccattctcgttcatctttctact-----atggcttcttctcacaccgctgtgttgatgcttttggttgcactgtttctgagttcc |
512 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| ||||||||||| | || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14317313 |
ttaaccctaatattcccattctccatcataattctactctactatggcttcttccaaaacagctgtgttgatgcttttggttgcactgtttctgagttcc |
14317214 |
T |
|
| Q |
513 |
gctgttgctcg |
523 |
Q |
| |
|
||||||||||| |
|
|
| T |
14317213 |
gctgttgctcg |
14317203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0902 (Bit Score: 75; Significance: 3e-34; HSPs: 3)
Name: scaffold0902
Description:
Target: scaffold0902; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 415 - 521
Target Start/End: Complemental strand, 3871 - 3765
Alignment:
| Q |
415 |
tagttaaccctaatattcccattctcgttcatctttctactatggcttcttctcacaccgctgtgttgatgcttttggttgcactgtttctgagttccgc |
514 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3871 |
tagttaaccctaattttcctattctccttcatctttctactatggcttcttccaaaaccgctgtgttgatgcttttggttgcactgttgctgagttccgc |
3772 |
T |
|
| Q |
515 |
tgttgct |
521 |
Q |
| |
|
|||||| |
|
|
| T |
3771 |
cgttgct |
3765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0902; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 320 - 265
Alignment:
| Q |
192 |
aagatcagttgaagaattgaaatactataaattggcaattgtttgttacgggagagg |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
320 |
aagatcagttaaagaattgaaatactataaattggtaattgtttgtta-gggagagg |
265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0902; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 172 - 217
Target Start/End: Complemental strand, 4221 - 4176
Alignment:
| Q |
172 |
tataatagtggttatatgataagatcagttgaagaattgaaatact |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
4221 |
tataatagtggttctatgataagatcagttgaagatttgaaatact |
4176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 3e-31; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 18342819 - 18342734
Alignment:
| Q |
8 |
tgatgataatgcggcggttctcattgataatgaaggaaatccaaaaggaactagaactgtttccgcaatagcccgagaattgagac |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
18342819 |
tgatgataatgcggcggttctcattgataaagaaggaaatccaaaaggaactcgaattttttccgcaatagcccgagaattgagac |
18342734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 8 - 59
Target Start/End: Complemental strand, 48288763 - 48288712
Alignment:
| Q |
8 |
tgatgataatgcggcggttctcattgataatgaaggaaatccaaaaggaact |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
48288763 |
tgatgataatgcggcggttctcattgataaagaaggaaattcaaaaggaact |
48288712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 420 - 500
Target Start/End: Complemental strand, 37245478 - 37245398
Alignment:
| Q |
420 |
aaccctaatattcccattctcgttc---atctttctactatggcttcttctcacaccgctgtgttgatgcttttggttgcactg |
500 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||| | |||||| |||| |||||||||||||||||||| |
|
|
| T |
37245478 |
aaccctaatattcccattctccttcttcatctttctactatggcttcct---acaccgttgtgctgatgcttttggttgcactg |
37245398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 3e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 36840592 - 36840507
Alignment:
| Q |
8 |
tgatgataatgcggcggttctcattgataatgaaggaaatccaaaaggaactagaactgtttccgcaatagcccgagaattgagac |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
36840592 |
tgatgataatgcggcggttctcattgataaagaaggaaatccaaaaggaactcgaattttttccgcaatagcccgagaattgagac |
36840507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 227 - 308
Target Start/End: Original strand, 1061 - 1142
Alignment:
| Q |
227 |
caattgtttgttacgggagagggatattttcttatgtaaagcttgtatctattaatctaaaataaatcctcacaaaacaaat |
308 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| || ||||||||| ||| |||||| |||||||||||||| |||||||||| |
|
|
| T |
1061 |
caattgtttgttacggcagaaagatattttcctaagtaaagcttatattaattaatttaaaataaatcctctcaaaacaaat |
1142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 476 - 510
Target Start/End: Original strand, 1206 - 1240
Alignment:
| Q |
476 |
tgtgttgatgcttttggttgcactgtttctgagtt |
510 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
1206 |
tgtgttgatgcttttggttgcactgtttctaagtt |
1240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1777 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold1777
Description:
Target: scaffold1777; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 165 - 217
Target Start/End: Original strand, 1318 - 1370
Alignment:
| Q |
165 |
gtttccatataatagtggttatatgataagatcagttgaagaattgaaatact |
217 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
1318 |
gtttccaaataatagcggttagatgataagatcagttgaagaaccgaaatact |
1370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1118 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1118
Description:
Target: scaffold1118; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 180 - 238
Target Start/End: Complemental strand, 79 - 18
Alignment:
| Q |
180 |
tggttatatgataagatcagttgaagaattgaaat---actataaattggcaattgtttgtt |
238 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |||||||| || |||||||||||| |
|
|
| T |
79 |
tggttttatgataagatcagttgaggaattgaaatactactataaactgacaattgtttgtt |
18 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1652 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold1652
Description:
Target: scaffold1652; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 487 - 521
Target Start/End: Original strand, 1 - 35
Alignment:
| Q |
487 |
ttttggttgcactgtttctgagttccgctgttgct |
521 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
1 |
ttttggttgcactgtttctgagttccgccgttgct |
35 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University