View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17233_low_5 (Length: 242)
Name: NF17233_low_5
Description: NF17233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17233_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 3 - 223
Target Start/End: Original strand, 39326829 - 39327049
Alignment:
| Q |
3 |
atcaaagctagggaagaggaaaggggaatatgataacaacttcacaaggtcaattttctatatcctaattgttgtatatgaaatagtaatgtggtcaatg |
102 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
39326829 |
atcaaagctagggaagaggaaaggagaatatgataacaacttcacaaggtcaattttctatatcctaattgttgtgtatgaaatagcaatgtggtcaatg |
39326928 |
T |
 |
| Q |
103 |
actcatggttttaaatcgaatagagtactagctagtataaacgattagatctcaaccagattaattatatctaaattaattgaattgtatagcacaaaaa |
202 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
39326929 |
actcaaggttttaaatggaatagagtactagctagtataaacgattggatctcaaccagattaattatctctaaattaattgaattgtatagcacaataa |
39327028 |
T |
 |
| Q |
203 |
tttatggtctcttaaataaag |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39327029 |
tttatggtctcttaaataaag |
39327049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University